Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12346B8
Clone ID IST12346B8
Vector VICTR76
Project tigm

Sequence tag IST12346B8BBF2
Sequence
GCCTGGTCTATGAAGTGAGTTCCAGGACAGCCAGAGTTATACAGAGAAACCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 105865115..105865166 50
NO GENE  


Sequence tag IST12346B8HMF1
Sequence
GCCTGGTCTATGAAGTGAGTTCCAGGACAGCCNNGGCTACACAGAGAAACCNNGNCTG
Sequence Type genomic DNA
Unitrap ID UNI35107 UNI35108

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 141530773..141530823 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030994 (D7Ertd443e) NP_001074800 Putative uncharacterized proteinMCG125306, isoform CRA_a ; [Source:UniProtKB/TrEMBL;Acc:Q9D4E0]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 32179715..32179765 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026825 (Dnm1) NM_010065 dynamin 1 Gene [Source:MGI (curated);Acc:Dnm1-005]

 
Come back to gene ENSMUSG00000026825


For any suggestions or comments, please send an email to unitrap@crg.es