Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST882-1
Clone ID PST882-1
Vector U3NeoSV1
Project escells

Sequence tag PST882-1
Sequence
ATCAGGACCTTTTGACATCTGTCTAATTAATTGAACATCTGTGAGGGATGCTTGTATCGTCTGTTCTTTGTCCCTGAATT
TATCTACCGTATAATACATATCGGGACCCTGTAATTTTTTTTTCATGGCTTAATAGTCCACCATAGCTTGGTTTTGTGGT
TATTCACAGGTGGGCTGGACTGGCAATCTGGAGAGGTGTTTGGAAGAGACCAGCCAGGCCGAGAGACCTGAAGCATAGAA
GGGGCTGTCTGTGCTCTCTTTTCCAAGTTGCTGGTCTGATGGTTGTACCATTAGGAAGAGAGGGGAGTCCTTGCTATCCC
AGGCTGCCTAGGATCAAGGGGCGGGCCTCCCAGTGACATCATTCTACTAAAAATCATTTTCTTCCTATTTTTAAAATTTT
TTTT
Sequence Type genomic DNA
Unitrap ID UNI2407

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 123054335..123054736 396
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031822 (Gse1) NP_941073 genetic suppressor element 1 Gene [Source:MGI (curated);Acc:Gse1-002]

 
Come back to gene ENSMUSG00000031822


For any suggestions or comments, please send an email to unitrap@crg.es