Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14329D6
Clone ID IST14329D6
Vector VICTR74
Project tigm

Sequence tag IST14329D6HMF1
Sequence
TTTCGAGACAGGGTTTCTCTGTATAGCCCTGGCTGTCCTGGGACA
Sequence Type genomic DNA
Unitrap ID UNI3901 UNI6771 UNI6913 UNI8010 UNI16370 UNI29961 UNI32797 UNI33015

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 21169691..21169734 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020128 (Vps54) NM_139061 vacuolar protein sorting 54 (yeast) Gene [Source:MGI (curated);Acc:Vps54-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 53627843..53627886 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042195 (Slc35f2) NM_028060 solute carrier family 35, member F2 Gene [Source:MGI Symbol;Acc:MGI:1919272]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 22265324..22265367 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039197 (Adk) NM_134079 adenosine kinase Gene [Source:MGI Symbol;Acc:MGI:87930]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 117268509..117268552 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 39491957..39492000 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038456 (Dennd2a) NM_172477 DENN/MADD domain containing 2A Gene [Source:MGI (curated);Acc:Dennd2a-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 49854548..49854591 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 151539905..151539948 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034021 (Pds5b) NM_175310 PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae) Gene [Source:MGI (curated);Acc:Pds5b-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 45669058..45669101 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 63174558..63174601 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027820 (Mme) NM_008604 membrane metallo endopeptidase Gene [Source:MGI Symbol;Acc:MGI:97004]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 57651274..57651317 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062949 (Atp11c) NM_001037863 ATPase, class VI, type 11C Gene [Source:MGI Symbol;Acc:MGI:1859661]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 60636652..60636695 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026970 (Rbms1) NP_064692 RNA binding motif, single stranded interacting protein 1 Gene [Source:MGI (curated);Acc:Rbms1-001]

 
Come back to gene ENSMUSG00000026970


For any suggestions or comments, please send an email to unitrap@crg.es