Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14807F4
Clone ID IST14807F4
Vector VICTR76
Project tigm

Sequence tag IST14807F4BBF1
Sequence
AAACTAAATGATCGCAACGTAGGGAACTCTCCAAATGCTCAGAAATACCACAAGTAAGTTGGGAAGCAGCAGTTTCACCC
ACCGGACAGTGGGCAGTTTTGTCGTTTTGCATGTTTTCCTCGAGGGAACCACGCGCACGGAAAAGTGAGGTCGTTTTAAA
CCCGTTGCCGAGTACGTAGGTAGGGCTAGGAGCGGAATGGTCGCAGAAAGGGTCGCTCCCAGGCCGGAGCGACTAGAAAG
GCCAGGCCGCGGCCTCAGGGCGCAGAGCCACCCCAGGACTCAGCCTCAGCAGGGCCGTCCCTTCCTCCGGTCAGGAGTTT
TGCGTTTCACCTCCAGGCGCGCCAGGGTGATGCCCGCTCCCCGAGATCGAGCGCANGACTCCGGCAAGGGTGATAGTCCA
CAACTCAAGCCAGACGTANCTGCANCAANGAACACTTCTCCNAACCGTAGTCNGTCCNCCCCCAACAGGGAGTCTGCANG
ANGCCTGCNNTGGANCGGATGCGCGCGANTCNNCGACNTAN
Sequence Type genomic DNA
Unitrap ID UNI35109

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 25187586..25188105 488
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036646 (Man1b1) NM_001029983 mannosidase, alpha, class 1B, member 1 Gene [Source:MGI (curated);Acc:Man1b1-001]


Sequence tag IST14807F4HMF1
Sequence
AAACTAAATGATCGCAACGTAGGGAACTCTCCAAATGCTCAGAAATACCACAAGTAAGTTGGGAAGCAGCAGTTTCACCC
ACCGGACAGTGGGCAGTTTTGTCGTTTTGCATGTTTTCCTCGAGGGAACCACGCGCACGGAAAAGTGAGGTCGTTTTAAA
CCCGTTGCCGAGTACGTAGGTAGGGCTAGGAGCGGAATGGTCGCAGAAAGGGTCGCTCCCAGGCCGGAGCGACTAGAAAG
GCCAGGCCGCGGCCTCAGGGCGCAGAGCCNCCCCAGGACTCAGCCTCAGCAGGGCCGTCCCTTCCTCCGGTCAGGAGTTT
TGCGTTTCACCTCCAGGCGCGCCAGGGTGATGCCCGCTCCCCGANANCGAGCGCANGACTCCGGCAAGGGTGATAGTCCA
CAACTCNAGCCAGACGTAACTGCNACAAAGAACACTTCTCCNAACCGTANTCAGTCCGCCCCCAACAGGGNNTCTGCNNN
ACNCCTGCAANGNNNCGGATGCNCNCGATTCANCGACGTANNNNNNCGATGAANNNACGNNAACGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000036646


For any suggestions or comments, please send an email to unitrap@crg.es