Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10659F6
Clone ID IST10659F6
Vector VICTR76
Project tigm

Sequence tag IST10659F6HMF2
Sequence
CTANAAAGGTCATGATTTATTTATAATTTACTGCCAAGTTCAACCNAAGAATACGTTGTTTCAGATGAGAAGTTGCTAGC
ATTTTAGATGCAAGCCCATCCTTGCATACCACATCCTTGCATACCGCTCAGCAGCTTCTCCTGAGCCACGTCCTTTCTGC
CATGGCTTTCCAGCCTGANAANAGAGTCTAGCCAAAGATCAGGCTCCGTGGCTGGAATGTANACTGTTA
Sequence Type genomic DNA
Unitrap ID UNI32464

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 20773063..20773290 218
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019986 (Ahi1) NM_026203 Abelson helper integration site 1 Gene [Source:MGI Symbol;Acc:MGI:87971]

 
Come back to gene ENSMUSG00000019986


For any suggestions or comments, please send an email to unitrap@crg.es