Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11504C12
Clone ID IST11504C12
Vector VICTR76
Project tigm

Sequence tag IST11504C12HMR1
Sequence
GTCTCNNTTTTATCNAACTTCAGTGGGAACATGGGCTTTGGATGGGAAGAGTGTGGGACAGTTCTCTGTTACCCATGTTC
CAGGCAATGTGAAAGGGTGAGGGANCTGCTANAATGGACAAACATTACNTGGGGCTGGANAACTNACTCACANGTAANAN
CNNNCTGTTGCTTTTGCANAAAACCANAGTTCAATTCCCANCACCCAACTGTGGCTCACAACCAATGTANCTCCNNTTGC
AGGGATCNGGNGCCNNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11504C12BBF1
Sequence
CNANGGAAATACAATAGATCAAAAGAAGACATTGGATTCTGTGTCTTTGTATTAATGAAGTCACAGTATAAACAGCAGCC
ATTTAAACAAAGACGTACCAAGAAATATATCAACTATAAAGGCCTATTAAAGGCCTATGGAATAAAAACTTTAAAACTCT
TCACACAACTCTAAACTTTAATGAAAACTTTTAAGTGTTGTAATTTCTCTTCTAGTTAATCTAAAATTTGGATTNNNNNN
GCCACTTATGGTTTTTTGTTTGGGTGCTTTTTGGCTTTTTTTTTTTTNAAN
Sequence Type genomic DNA
Unitrap ID UNI35110

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 58350448..58350733 272
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027810 (Eif2a) NM_001005509 eukaryotic translation initiation factor 2, subunit 1 alpha Gene [Source:MGI (curated);Acc:Eif2a-001]

 
Come back to gene ENSMUSG00000027810


For any suggestions or comments, please send an email to unitrap@crg.es