Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12968G8
Clone ID IST12968G8
Vector VICTR76
Project tigm

Sequence tag IST12968G8HMF1
Sequence
GTTTTGGTAGTTGAAACTGAGACGTAGCATTTTGGCCTTGTAGGGTATATTCACAGTANAAAACGTGTGCTGGAATTTCA
CAATGCTGCTAACGATANCATCTTGAACGACCTTCANTGGAGAAATGTAAATGCTCTTCTATATACAATAAAAAATATCA
CTTTCATTAAAATGTACATATGTTCCTTACAAAANCAAATGCCTCTTGATCAANANCANGTATAGTGTTGGTTTATTTNN
NANNANGTANGGAANGANNAAAATGGACTGTTACATGCACNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12968G8BBF1
Sequence
GTTTTGGTAGTTGAAACTGAGACGTAGCATTTTGGCCTTGTAGGGTATATTCACAGTAGAAAACGTGTGCTGGAATTTCA
CAATGCTGCTAACGATAGCATCTTGAACGACCTTCAGTGGAGAAATGTAAATGCTCTTCTATATACAATAANAAATATCA
CTTTCATTAAAATGTACATATGTTCCTTACAAGAGCAAATGCCTCTTGATCAAGAGCAGGTATAGTGTTGGTTTATTTTG
TATTAGGTATGGAAGGAAAAAAATGGACTGTTACATGCACTTTCTTGGAAAGTTGAAGGGGGGGGTTCCAATTTCNTAAA
CATTNAANACTTACTAACAACNNANNNNCTGTAATTTNNCNCNNNTT
Sequence Type genomic DNA
Unitrap ID UNI7886

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 91551182..91551538 333
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031665 (Sall1) NM_021390 sal-like 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1889585]

 
Come back to gene ENSMUSG00000031665


For any suggestions or comments, please send an email to unitrap@crg.es