Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14521B4
Clone ID IST14521B4
Vector VICTR74
Project tigm

Sequence tag IST14521B4HMF1
Sequence
AGTCTTTGAAGTCTTTGATNATATTTTTCCCTACAAGTTGAGACTTCTGTTTGTTCTTTTANAATCAAGGTTGTCTTTAC
ATTGTTTTTTTTTTTNAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84858230..84858327 92
NO GENE  


Sequence tag IST14521B4BBF1
Sequence
AGTCTTTGAAGTCTTTGATCNTATTTTTCCCTACAAGTTGAGACTTCTGTTTGTTCTTTTAGAATCAAGGTTGTCTTTAC
ATTGTTTTTTTTTTTNAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84858230..84858327 94
NO GENE  


Sequence tag IST14521B4HMR1
Sequence
GACTCTTTGGTGTAAAGCCNGGAGTGGTGGCTCACGCCTGTGATCATCAGTCCCAGGCACTCGGGAGGAGAAGGTGGGGT
TANCGCCACAAATTTGAGGCCAGCCTGAGCTACAGAATGAGCCCCAGTCTTGAGAAAGCAAATGGTCATGTGCAAGCTGT
GCCATATAACACAGGCAAAGAACATGTCACACTGTTCATGGCACACTGTCANAATGTTATTGAATAACTATAAATTGACA
AGGTTTAAAGGATCCAAAGGCANAAACTCATCATAAAATCTGCCTCCCTGANTANCCTGGCN
Sequence Type genomic DNA
Unitrap ID UNI13061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84858324..84858624 289
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]

 
Come back to gene ENSMUSG00000073633


For any suggestions or comments, please send an email to unitrap@crg.es