Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11409G5
Clone ID IST11409G5
Vector VICTR76
Project tigm

Sequence tag IST11409G5HMF1
Sequence
CTCCCTCCTTCTGATCCCAGGCTCAGGTCCAGTCCCATAATGTACAGTCAGATTTCCACCTGCTGCCATATTGAGTCCAC
TGTTACCACACCATCGAGGCAGCCCTAACTCAAAAACACTGGCTTTCCACAGTCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 17214072..17214205 134
NO GENE  


Sequence tag IST11409G5HMR1
Sequence
GGAGAAAGTTTCANAGCCNCAGACAGGAAGACAGTTGGAGGACTTGGAAATGGAANACANCNNGGACCCATGGGTTGTTG
CTCAGGGACTTGTCAAGCTTGAGGTTGGATGTTGGCGTCATAAAGCATGCAGATAATGAGAAAAGGACCACCAAAGTCAG
ATGTAAGGCAAAGGCAACTTTATTTACCAGGGGAAAATGCTAACTGGTTAGGTTCACAGTCC
Sequence Type genomic DNA
Unitrap ID UNI13002

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 17214202..17214422 209
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039126 (A230083H22Rik) BNIP2 motif-containing molecule at the C-terminal region 1 [Source:UniProtKB/Swiss-Prot;Acc:Q52KR3]

 
Come back to gene ENSMUSG00000039126


For any suggestions or comments, please send an email to unitrap@crg.es