Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST1370-1
Clone ID PST1370-1
Vector U3NeoSV1
Project escells

Sequence tag PST1370-1
Sequence
CGTTGGGGGNTNCCGGCAGGNTGANGGGNCGGNTNNNNCGGNGNGGGCNNTNNCNGGGTTTTNGNANNGGGGNTCTCGGG
GAGCCTNGNCCTCTGGAGATCNGGCCGGCTTTGGNCTCNGNNTTTNGCNTNCCNTTGCTNCAAGTGNTNGGATTNNATGC
GGCCCCCNCCACNGCCTGGCTCAGGTATTCNGGNGGGGGNTTTNTTTAAAGATTTATTTATTATATGTAAATACACTGTA
GCTGTCTTCAGACACACCAGAAGAGGGAGTCAGATCCTTGTTACGGATGGTTGTGAGCCACCATGTGGTTGCTGGGATTT
GAACTCTGGACCTTTGGAAGAGCAGTCGGGTGCTCTTACCCACTGAGCCATCTCACCAGCCCCTTCAGCTATTCTTAAAA
TAGCAATATAACCTATTATCAGGAAGATAA
Sequence Type genomic DNA
Unitrap ID UNI138

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 84322444..84322972 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018697 (Aatf) NM_019816 apoptosis antagonizing transcription factor Gene [Source:MGI (curated);Acc:Aatf-001]

 
Come back to gene ENSMUSG00000018697


For any suggestions or comments, please send an email to unitrap@crg.es