Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST97-1
Clone ID PST97-1
Vector U3NeoSV1
Project escells

Sequence tag PST97-1
Sequence
TCTAAANTAACCAACTTCTAGCTTTTTAAAAATAAGTTTGGTGGCCCACAAGATAGCTCAACTGGTAAAATGCCTGCTGA
CCCTATTGACGCTCCGAGGACCCACAGTGAAAGGAAAGAATCAACTTCACAGAGTTGGCCTCTGGCCGTCACANAACTAC
ATCCCCATA
Sequence Type genomic DNA
Unitrap ID UNI15352

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 75130334..75130495 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000751 (Rpa1) NM_026653 replication protein A1 Gene [Source:MGI (curated);Acc:Rpa1-001]

 
Come back to gene ENSMUSG00000000751


For any suggestions or comments, please send an email to unitrap@crg.es