Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AL0109
Clone ID AL0109
Vector pGT0lxr
Project sanger

Sequence tag AL0109
Sequence
GCGCTTACTACTAGGCCTCCATCATATGCTGACCTTCTTTGTTCTTCATGATGCTATGGATGGAGAACTATCCTGCCGTG
TTTTTCAGCTTATATCTTTAATGGATACCAGATTACCTCACTGCACCAATGAGAAAATAGAGCTTGCAGTTCTCTGGTTC
CTGGATCAGTTTCGTAAAACATATGTTGGTGATCAGCTTCAAAGAACCTCAAAG
Sequence Type mRNA
Unitrap ID UNI2713

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 33341803..33352475 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040594 (Ranbp17) NM_023146 RAN binding protein 17 Gene [Source:MGI (curated);Acc:Ranbp17-001]

 
Come back to gene ENSMUSG00000040594


For any suggestions or comments, please send an email to unitrap@crg.es