Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10831H9
Clone ID IST10831H9
Vector VICTR76
Project tigm

Sequence tag IST10831H9HMR1
Sequence
NAGCTCTCCAGCCTTGTAAAAGGTTCCTCTCAGGCTTCGTTCTGTGCACTGGCAGACAGTCTTAAGTCTTANAAAGTGAA
GCATCTGTCACATGGGGGTTT
Sequence Type genomic DNA
Unitrap ID UNI14831

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 102177515..102177614 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020923 (Ubtf) NM_001044383 upstream binding transcription factor, RNA polymerase I Gene [Source:MGI (curated);Acc:Ubtf-002]

 
Come back to gene ENSMUSG00000020923


For any suggestions or comments, please send an email to unitrap@crg.es