Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11958F11
Clone ID IST11958F11
Vector VICTR76
Project tigm

Sequence tag IST11958F11BBF1
Sequence
GTCCAAATGGAATTGTTGTTGTTGTTAATACCAAGTGGTCCCAAATGGTTCNNATAGAAATTTTTTC
Sequence Type genomic DNA
Unitrap ID UNI25304

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 28160256..28160322 63
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021895 (Arhgef3) NM_027871 Rho guanine nucleotide exchange factor (GEF) 3 Gene [Source:MGI Symbol;Acc:MGI:1918954]


Sequence tag IST11958F11HMF1
Sequence
GTCCAAATGGAATTGTTGTTGTTGTTAATACCAAGTGGTCCCAAATGGTTCAAATAGAAATTTTTTCTTGTTGTTGATAT
TATAGTTATTGTTATTGTTATTATTATTACTACTACTACTATTTTTTTTAATAAAANATATTCTAANCACACTGGCAAGC
CTCACATCTTTCTTTGCAGGTAGGCNAAACATATCTGTGGTGTGATTTTATANTTCCTANCATGANTTTTAAACAGGANA
TGGTGTGTGANTCTN
Sequence Type genomic DNA
Unitrap ID UNI25304

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 28160256..28160509 238
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021895 (Arhgef3) NM_027871 Rho guanine nucleotide exchange factor (GEF) 3 Gene [Source:MGI Symbol;Acc:MGI:1918954]

 
Come back to gene ENSMUSG00000021895


For any suggestions or comments, please send an email to unitrap@crg.es