Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10874B4
Clone ID IST10874B4
Vector VICTR76
Project tigm

Sequence tag IST10874B4BBF1
Sequence
CCTTGAGCTGACAGCCTACCTGTGCCTCCTAAGTGCTGGGATCGCCGGCCTGCACCACCATAGTGCCAAGCCAGTACAGG
CAACTTCCACCAGGCTGCTCCAGAGAAGTCCCTGACAAGATGGTGTTTGGCTTGGGATCT

Sequence Type genomic DNA
Unitrap ID UNI20095

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30747016..30747154 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050737 (Ptges) NM_022415 prostaglandin E synthase 3 (cytosolic) Gene [Source:MGI (curated);Acc:Ptges-001]

 
Come back to gene ENSMUSG00000050737


For any suggestions or comments, please send an email to unitrap@crg.es