Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15078B8
Clone ID IST15078B8
Vector VICTR80
Project tigm

Sequence tag IST15078B8HMF1
Sequence
CAGTGTATGGTTCTAACTGCAGGTCACAGCACTATGCCACAATGTTAGAAGCTGGAAGGCCAGATGTGAGGAGGAGCCTG
GGAGTCCCCAGAGCCCAGCAGGGATTGAAAGGGCACAGCACACAGTCCAGGGACGGGCAGCCAATACTCACTTCATCCGC
TCTGCGTCAGTCAGGGACTCCTGGACAAAAAAAGAGGGGAAGCCTGGGACTCAGCTCCAGAGCACTGGCCTCCTGGTTGG
CTCAGAGCCCTGGAAAAGGCCACGTCACGGAAAGTGACAGGCCCTCCAGAAATGGATGAAATCTAGAAACATCTGGTAAG
CTTACAGTACCCTTTCCCCTGTCAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 46399200..46399545 346
 
EST/CDNA Est Name
  CD565291.1 - CF916062.1 - BB872924.1 - BY285796.1 - AW106046.1 - BY014889.1 - BB852938.1 - BY241587.1 - BY067615.1 - BY223250.1 - BY237237.1 - BY033252.1 - BY784174.1 - BY033751.1 - BF585355.1 - BU610720.1 - BQ884502.1 - CN675287.1 - CK344403.1 - CA879998


Sequence tag IST15078B8HMR1
Sequence
ACTGGAATTACAAACAATTACAAGCAATTTGCAGGACAGTGTTCCTTTTAACTGAGTTTGTGGGGTTTGTGTT
Sequence Type genomic DNA
Unitrap ID UNI35115

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 46399131..46399203 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000012296 (Tjap1) NM_028751 tight junction associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1921344]

 
Come back to gene ENSMUSG00000012296


For any suggestions or comments, please send an email to unitrap@crg.es