Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14902G6
Clone ID IST14902G6
Vector VICTR76
Project tigm

Sequence tag IST14902G6HMF2
Sequence
ATCCTTGCACACATGCAGACTAGAGGGAGGGAGGCAGGCGTGCTCTGGAAGCTCCCGGTGCTCAGGTATAGTGGGAGATT
TGGCGCCCCTGCTCAGGCCCGGGGTCGAGCAGGCGCACAGTGATGTGGCTGATGCGTGGGAGCAAATCCTGGACGACAGA
TACAGCGGAAGGAGCCGTCAGTGTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28090323..28090507 185
 
EST/CDNA Est Name
  BX640031.1 - D77459.1 - BF454970.1


Sequence tag IST14902G6HMR1
Sequence
GATGTCNGACAGTCTCGACTTAGGATGGACAGACACAGAGGGGTGCCTTCTATGGTGCCAGCCTGTCATGCCCAGTCCCT
CCCACCAGTGCCCTGGGCCTGTCCTGGGTCCCCTGACACATTTCTTGCCCTTTTATACAATTTTCAATTAAAACACCTAT
TTTGTACTTTCNGCCTCTGCCTGCCTTTTTCTTTTTCTCAAAAGCTGGCTCCACTGTGCGCTGAGTCACTCCTCGGAACG
CGCCATTCCTGCCGCCAAGACTGANACTCACTTTCCATGACTCTCACTGAGTCTAGCTTTGTCCCTCTTGGCCTCCANTC
TCNNTTTCTTTCTCTTCCCCGTTTCNTCGTCTTTCTCTCTGGN
Sequence Type genomic DNA
Unitrap ID UNI21265

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28089964..28090325 348
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040488 (Ltbp4) NM_175641 latent transforming growth factor beta binding protein 4 Gene [Source:MGI (curated);Acc:Ltbp4-001]

 
Come back to gene ENSMUSG00000040488


For any suggestions or comments, please send an email to unitrap@crg.es