Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST1519-1
Clone ID PST1519-1
Vector U3NeoSV1
Project escells

Sequence tag PST1519-1
Sequence
GAATTCCGGGCTGTGCTGGGAGAAGTGGCCCTGTACTCGGGGGCCAGGTCTGTCACTCAACAGCCAGGTGAGGAGGATGG
GAGACAGCAGAAT
Sequence Type genomic DNA
Unitrap ID UNI15166

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35141454..35141544 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007029 (Vars) NM_011690 valyl-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:90675]

 
Come back to gene ENSMUSG00000007029


For any suggestions or comments, please send an email to unitrap@crg.es