Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14820C9
Clone ID IST14820C9
Vector VICTR76
Project tigm

Sequence tag IST14820C9HMR1
Sequence
GTACCCATACACATTCAACCTCAAACATGTACCCCTAGGGGACCTTATGCATGATGGACAAGTGTTCCACCCTTGAGGTG
CACCCTCACATCTGTGGCTGGATACCCAGGCTCCCTGCAGAGGCCAGGTATAGAGTCCTATGTTCTTGAAAGTTGTCTTT
GCCAGCGGTTGAAGTGGTTTTCCATCCTGCTGTTGCGGGTGCCCTCTTGCTCTGANAAGCCCATGCTGCCACCCTTANAC
TCTGCTCTTGCATCTGGCCNNCTTA
Sequence Type genomic DNA
Unitrap ID UNI10818

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 80262907..80263170 256
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020211 (Sf3a2) NP_038679 splicing factor 3a, subunit 2 Gene [Source:MGI Symbol;Acc:MGI:104912]


Sequence tag IST14820C9BBF1
Sequence
GTACCCACTGCAAAAATGCAGTTAGTTCATGAGCTTTGGAGGGAAAACAAACACTAGGACAAAACTGGCCTGGGCAGGCT
GGAGAAGTGGCTCAGCGGTTAANAGCACTGACTGCTCCTCCAGAGGTCCTGAGTTCAAATCCCAGCAATGATGTGGTGGT
TCACAAACATCTGTAATGGAACCCGATGCCCTCTTCTGGTGTGTATCTAAAGACAGCTACAGTGTACTCATTATAAATAA
ATAAATCTTAGAAAAGCAAAACAAAACTGGGGCCTGGGTGAGCACACTGCTTGCTCTGTGGATGGGGCACCAAGCTCTGC
AAACGCCCACCAACAGTTCCCAACCCCAGGAAACACAGAAAACGTANGGCGTGGTGGTGTACACTTCTCATCCCATTTCT
TTATCCAAGGTANGAANATGGTTANGTTANTGTTANANACNNNNCCGGGCTGTGCAGTGAGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 80262447..80262910 440
NO GENE  

 
Come back to gene ENSMUSG00000020211


For any suggestions or comments, please send an email to unitrap@crg.es