Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST1293
Clone ID PST1293
Vector U3NeoSV1
Project escells

Sequence tag PST1293
Sequence
TTCTGGCCTTCTTGTGTTCTCTAGATTGGCCCTCGCCGCATACACACAGTCCGAGTTCGAGGAGGCAATAAGAAGTACCG
TGCCCTGAGATTGGATGTGGGGAACTTTTCCTGGGGCTCTGAGTGTAAGTAGGTGTTGAAGTATTTGAATTTGTTCTTGC
TGAAAGATCCTGAGGG
Sequence Type genomic DNA
Unitrap ID UNI3150

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116827562..116827736 175
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047675 (Rps8) NM_009098 ribosomal protein S8 Gene [Source:MGI (curated);Acc:Rps8-001]

 
Come back to gene ENSMUSG00000047675


For any suggestions or comments, please send an email to unitrap@crg.es