Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14871E5
Clone ID IST14871E5
Vector VICTR76
Project tigm

Sequence tag IST14871E5BBF1
Sequence
AAACCATCCCTATTGTTGCCCCATTTTCTGCTTCATCTCCTATGCGCCTCGCCCTGTTGACTATCGCCACATCTGGCTGC
AATTAAATAAGAAGATAAGATTTTTTAAAAAGGGATAGGTAGGTAGGGTGGCTCTGGGCTCCAAACCTCAGCACTTGGGA
GGCTGAAGCAGGAGGATCAAGAGCTCCTACCTAGCAGGGATAGCCTGTCTCAAAAGAGGCACAGGACATAGGTTTGATTC
CCCAGTGCCATAAAAAATAAACTTAAAAGCCTGGCGTGGTGGNNNNNNCCTTTGTTCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6060875..6061172 286
NO GENE  


Sequence tag IST14871E5HMF1
Sequence
AAACCATCCCTATTGTTGCCCCATTTTCTGCTTCATCTCCTATGCGCCTCGCCCTGTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6060875..6060932 58
NO GENE  


Sequence tag IST14871E5HMR1
Sequence
GTTTAGAAAATTTAGTTTCCNGAACTCTCAGAGTTC
Sequence Type genomic DNA
Unitrap ID UNI1668

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6060844..6060878 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038587 (Akap12) NM_031185 A kinase (PRKA) anchor protein (gravin) 12 Gene [Source:MGI Symbol;Acc:MGI:1932576]

 
Come back to gene ENSMUSG00000038587


For any suggestions or comments, please send an email to unitrap@crg.es