Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10931E11
Clone ID IST10931E11
Vector VICTR76
Project tigm

Sequence tag IST10931E11HMR1
Sequence
CTNNCCTTAAAAATCCGGCATTTAGACAAAGGTCGGGATTCCTTCAGGGATTTAAGAAGGTGGTTCCTACTTCCTAAAAG
GAGTCTTATTTCTGGCAAAAGCCGTATTGCTTCTCCATTAACCTGGATGGTTACCTATTAGTATATCGAAGTCTATGCTA
GCCTCTAGGTTCTCTCAGCCCATACTCACAAGTTCCTGTTAGAGTGGTCTTGGCTGACACACCCCTTCCCCTGCCCTAAN
CCTCTCGTCTCCNGCTCCCGANANTCNCTTCACTTCCCTCANCTTCTCTTTCCTATGTAAGTCAGCCNTTTCGATTANGC
GTTNTGTATGCNNTCTCCTGGTGGGTCTCTNTN
Sequence Type genomic DNA
Unitrap ID UNI22412

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8913703..8914048 324
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023156 (Rpp14) NM_025938 ribonuclease P 14 subunit (human) Gene [Source:MGI Symbol;Acc:MGI:1914303]


Sequence tag IST10931E11BBF1
Sequence
AATTAATTTGTTTGTTTGTTTAGCGTTTATTCCTCTGTGTAACGGAGTCCTGAAACTCACAGATCACCTGCCACTGCCTC
CTAGGCGCTGGAATTAAAGGCGTGTTGAAACAATTTCTTAAGACCTAACACTCTGGGCTTCCTCCTCCTCTTGGCCTCGG
CATCGCCTCTGGGTAGCCACGTGTCTCACACTCTCCANCCTCTCTGATCTTACTCAATGTGTCCCACTGCCCATCCTATC
TATTATGGTACCATACCCTCCTTGCCTAGTTCTTGCAAGTTCTCCCCTTCTGCTTCAGTGTCTGCNCTCCGAAACAGANA
TCTGT

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8913371..8913694 318
 
EST/CDNA Est Name
  AW538227.1 - AW540562.2

 
Come back to gene AW538227.1 - AW540562.2


For any suggestions or comments, please send an email to unitrap@crg.es