Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14997A10
Clone ID IST14997A10
Vector VICTR78
Project tigm

Sequence tag IST14997A10HMF1
Sequence
CAGGACAGCCAGGGCTATACAGAGAAACCCTGTTTCGAAAAACC
Sequence Type genomic DNA
Unitrap ID UNI19532 UNI31458 UNI35119 UNI35120

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 36924714..36924757 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 55991247..55991290 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 26023473..26023516 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 13661584..13661627 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 16889188..16889231 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 37306946..37306989 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043153 (4930579E17Rik) NP_848744 RIKEN cDNA 4930579E17 gene Gene [Source:MGI Symbol;Acc:MGI:1923097]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 6390729..6390772 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 56213052..56213095 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074305 (C230081A13Rik) NP_766512 RIKEN cDNA C230081A13 gene Gene [Source:MGI Symbol;Acc:MGI:2442366]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 16234843..16234886 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 106416758..106416801 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035948 (Acss3) NM_198636 acyl-CoA synthetase short-chain family member 3 Gene [Source:MGI Symbol;Acc:MGI:2685720]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 107744497..107744540 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 6764048..6764091 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 86331651..86331694 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 69421446..69421489 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 108389699..108389742 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034557 (Zfyve9) NM_183300 zinc finger, FYVE domain containing 9 Gene [Source:MGI (curated);Acc:Zfyve9-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 87832731..87832774 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 65002270..65002313 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 23540205..23540248 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 153084290..153084333 44
NO GENE  


Sequence tag IST14997A10BBF1
Sequence
CAGGACAGCCAGGGCTATACAGAGAAACCCTGTTTCGAAAAACC
Sequence Type genomic DNA
Unitrap ID UNI19532 UNI31458 UNI35119 UNI35120

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 36924714..36924757 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 55991247..55991290 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 26023473..26023516 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 13661584..13661627 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 16889188..16889231 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 37306946..37306989 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043153 (4930579E17Rik) NP_848744 RIKEN cDNA 4930579E17 gene Gene [Source:MGI Symbol;Acc:MGI:1923097]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 6390729..6390772 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 56213052..56213095 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074305 (C230081A13Rik) NP_766512 RIKEN cDNA C230081A13 gene Gene [Source:MGI Symbol;Acc:MGI:2442366]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 16234843..16234886 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 106416758..106416801 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035948 (Acss3) NM_198636 acyl-CoA synthetase short-chain family member 3 Gene [Source:MGI Symbol;Acc:MGI:2685720]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 107744497..107744540 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 6764048..6764091 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 86331651..86331694 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 69421446..69421489 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 108389699..108389742 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034557 (Zfyve9) NM_183300 zinc finger, FYVE domain containing 9 Gene [Source:MGI (curated);Acc:Zfyve9-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 87832731..87832774 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 65002270..65002313 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 23540205..23540248 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 153084290..153084333 44
NO GENE  


Sequence tag IST14997A10HMR1
Sequence
CCTGGAACTCACTTTGTAGACNAGGCTGGCCTCGAACTCANAAATCCGCCTGCCTCTGCCTCCCGAGTGCTGGGATTAAA
GGTGTTCGGCACCACCAAAGTTTTTGTTATTGTTTTTCTGGTTTGCTTTTAAAGACAAGAGTTTCTCTGTGCTGCCCTAN
AACTTGTTCCATANACCAGGCTGGCCTTGAACCACAAAGATCCAGCTGCCTTCTGGGATCAAAGCCATGTGCCACCCCTG
CCCAACTTGTTTTTATGTTGGGATTTCACCATCCCAGGCTGGTTACNCATTTGGTATGAAATTAAAAGTGACCTTGCATT
TCTAATCCTCCTGTCCCTAAATTCTGAGAATTCACTACCNACTGAGGTATATCTCCAGTCCCAGATACCAAGGTCTTTTG
GGTTTGTTTCTTTCCTTTANTTNANTCTAAAATAGTCANANNANCNCTGTAACCTTGGCTGTCCNGNTACNANCTCTGTA
AGCCAATCANNNCNCTCTGCCTTTGCTGGGACTNATGGCGTGCTCTGNNNTACNNNCTGGACANNAATTTTNAGGGAAAT
ATGCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000034557


For any suggestions or comments, please send an email to unitrap@crg.es