Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10655G6
Clone ID IST10655G6
Vector VICTR76
Project tigm

Sequence tag IST10655G6HMF1
Sequence
TGAGTTACCCTAAATTTCCCAAGTCTGGAGAACGTCCGGGAAAGGACTTGGAAACAGCTGCGAAGGATTCGGTCACAGGT
ATCTCAACCACCTCGGAGGGTGCAAGATGCACGCGCGGGGCAGTTCCTCCTGTTCANAACACTCAGCCCACAGCTGACTC
CCACTTCCGTACGATAACGCAAGATGGTGGGACCGGCGATTGAAAACCACATTCAAGATGTCGGCTTCCGGTTTTCCCGG
CAGCGTCCCGCGTGGCTGCCGGGGCCACGCCCACTTCCGGTTCCCTTGCTCCGGCATGGCTGCCTTANGGACCTGGCTGT
CCAGTGAGTGATTGTGGGGTTGGGGACACGGGAGCCGCGGGGCGACCANCCCTCTAACTCCCTGCTCTTCCATTANGTGT
CCGGANATTGCACTGCAGCGTANTGGCGCGGGCCGGTGGA
Sequence Type genomic DNA
Unitrap ID UNI32048

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55045475..55045913 427
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000010406 (Mrpl52) NM_026851 mitochondrial ribosomal protein L52 Gene [Source:MGI Symbol;Acc:MGI:1916086]


Sequence tag IST10655G6BBF1
Sequence
TGAGTTACCCTAAATTTCCCAAGTCTGGAGAACGTCCGGGAAAGGACTTGGAAACAGCTGCGAAGGATTCGGTCACAGGT
ATCTCAACCACCTCGGAGGGTGCAAGATGCACGCGCGGGGCAGTTCCTCCTGTTCAGAACACTCAGCCCACAGCTGACTC
CCACTTCCGTACGATAACGCAAGATGGTGGGACCGGCGATTGAAAACCACATTCAAGATGTCNGCTTCCGGTTTTCCCGG
CAGCGTCCCGCGTGGCTGCCGGGGCCACGCCCACTTCCGGTTCCCTTGCTCCGGCATGGCTGCCTTANGGACCTGGNTGT
CCAGTGAGTGATTGTGGGGTTGGGGACACGGGANCCGCGGGGCGACCANCCNTNTAACTCCCTGCTCTTCCATTANGTGT
CCGGAGATTGCACTGCAGCGTAGTGNCNCGGGCCGGTGGCCNGTGGCGACTNNNNNGAGTGCCNGNGCCCGGGCGGGGGC
NCN

Sequence Type genomic DNA
Unitrap ID UNI19446

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55045475..55045952 438
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000010406 (Mrpl52) NM_026851 mitochondrial ribosomal protein L52 Gene [Source:MGI Symbol;Acc:MGI:1916086]

 
Come back to gene ENSMUSG00000010406


For any suggestions or comments, please send an email to unitrap@crg.es