Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14698D1
Clone ID IST14698D1
Vector VICTR76
Project tigm

Sequence tag IST14698D1HMR1
Sequence
ANGGTGTGGTACATGCCTATAATCCTAACATTTAAGATGCTCAGGCAAGAGGATCANTATTTCAAGTTTATCCTTAGCTG
GTTAGAAAGTTGTAGTCCAGGCAAGACTGTCTGAGACC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95364708..95364823 114
NO GENE  


Sequence tag IST14698D1HMF1
Sequence
CCTGGAGCAATACATTGACCTCTTTTTTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI35124

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95364823..95364867 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028109 (Hormad1) NM_026489 HORMA domain containing 1 Gene [Source:MGI (curated);Acc:Hormad1-002]


Sequence tag IST14698D1BBF1
Sequence
CCTGGAGCAATACATTGACCTCTTTTTTTTTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI35124

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95364823..95364870 48
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028109 (Hormad1) NM_026489 HORMA domain containing 1 Gene [Source:MGI (curated);Acc:Hormad1-002]

 
Come back to gene ENSMUSG00000028109


For any suggestions or comments, please send an email to unitrap@crg.es