Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14981F10
Clone ID IST14981F10
Vector VICTR76
Project tigm

Sequence tag IST14981F10HMF1
Sequence
TTCACTCTCCTTCCTTAGCGATGGCAGGGCAAACTCTGTACCGGCTGATTTTGTGTGTCANCG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27826633..27826691 59
NO GENE  


Sequence tag IST14981F10HMR1
Sequence
TTATGGAAGTCACTGGGCATGAGCAGAATCTGACACAGCTGTGGCTGGA
Sequence Type genomic DNA
Unitrap ID UNI35125

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27826691..27826736 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040276 (Pacsin1) NM_011861 protein kinase C and casein kinase substrate in neurons 1 Gene [Source:MGI (curated);Acc:Pacsin1-001]


Sequence tag IST14981F10BBF1
Sequence
TTCACTCTCCTTCCTTAGCGATGGCAGGGCAAACTCTGTACCGGCTGATTTTGTGTGTCAACTTGACGAGGGCTGGAGTT
ATCATAGAGAACAGAGCCTCCCTTGAGGAAATGCCTCCATGAGGTCCAGCTGTGGCATTTTCTCAATTAGTGATCAAGGG
GGGAGGGCTCCTTGTGAATGGTGCCATCCCTGGGCTGGTANTCCTGGGTTCTATAANAGAGCAAGTTGAGCAAGCCAGGG
GAAGCAAGCCAGTAAGCAGCACCCCTCCATGGTCTCTGCATCNNCTCCTGCCTNNANGTTCCTGCCCTGTGTNANTTCCT
GNNNNNACTTCCTTTGGTGATGAACAGCAATGTGCCCCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27826334..27826691 330
 
EST/CDNA Est Name
  BE946088.1 - AW457702.1

 
Come back to gene BE946088.1 - AW457702.1


For any suggestions or comments, please send an email to unitrap@crg.es