Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12400A12
Clone ID IST12400A12
Vector VICTR76
Project tigm

Sequence tag IST12400A12HMF1
Sequence
CAAGCATGACAGGATATGAACTTTTCATAAGAATAGAGCACAGTTGTGTTACCATAGTGTTTTTGTTTGATCAGGAGCAG
AAACCCTTGCAGTTACACAAGCAAAACAATACAGGTTANCAAAAGTTCCTGTACATGCATGAGGGTCAGGCTGGCTTCAG
GTTTAACCCNAAGTCTGGA
Sequence Type genomic DNA
Unitrap ID UNI33227

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 12753853..12754030 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031010 (Usp9x) NM_009481 ubiquitin specific peptidase 9, X chromosome Gene [Source:MGI (curated);Acc:Usp9x-001]

 
Come back to gene ENSMUSG00000031010


For any suggestions or comments, please send an email to unitrap@crg.es