Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12980A1
Clone ID IST12980A1
Vector VICTR76
Project tigm

Sequence tag IST12980A1HMF2
Sequence
GTACAAAGAGGTTACTGGATTCTTACACAAAACAGAGGAATACAAACACAGAAGGTCTAACAGGAACCACCTGGGATAGA
ATTCATGGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI7587

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 38168021..38168113 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022812 (Gsk3b) NM_019827 glycogen synthase kinase 3 beta Gene [Source:MGI (curated);Acc:Gsk3b-001]


Sequence tag IST12980A1BBF1
Sequence
GTACAAAGAGGTTACTGGATTCTTACACAAAACAGAGGAATACAAACACAGAAGGTCTAACAGGAACCACCTGGGATAGA
ATTCATGGTTAACAACTGGGATCAAAAAGAGCTCCACCTAAGGTCCACTTAATCTTANAAGCCAGGGTCAAGGACTTCGT
GCCCTTGCCATANTTCCTATTTTAGTCTATTGTATAGTCCACCTTCCCCCTAGGCCATTGTAAATTCATATGTATGGGTG
TAACTCAGCTATCTATAGTTCTAAGTATCTACTCTGGTTCCTCCTTAGGTCTCAAACGTCCTTCTTCCTAGATGATGGTA
AATTCCTGTGTANGGCANTGACTTANCTTTTATTCNAAGTGATAGTGTAATGCCNNANGCTATTCTGAATGTCACTGAAT
ANGCNACATTCTTACTGAATTCCAAGCCCATGGTCTGCTNAAGGANTTTCTNNNANTTGGAACACTGGTGAANGCTTN
Sequence Type genomic DNA
Unitrap ID UNI7587

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 38168021..38168498 438
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022812 (Gsk3b) NM_019827 glycogen synthase kinase 3 beta Gene [Source:MGI (curated);Acc:Gsk3b-001]

 
Come back to gene ENSMUSG00000022812


For any suggestions or comments, please send an email to unitrap@crg.es