Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12358B9
Clone ID IST12358B9
Vector VICTR76
Project tigm

Sequence tag IST12358B9BBF1
Sequence
ATATAAAGGCAGACCTATCAGAATTACACCAGACTTCTCACCAGAGACTATGAAAGCTAGAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI33924

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 8956402..8956468 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20064137..20064203 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 116124604..116124670 67
NO GENE  

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es