Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14134H9
Clone ID IST14134H9
Vector VICTR74
Project tigm

Sequence tag IST14134H9BBF1
Sequence
AGANAAGAACTTACAACCGTCATTTTACTAAGCCNGCAAAACCATTAATTACTTTCTTTTTTTTTTTTTTTTTTNANNAA
AAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14134H9HMR1
Sequence
CTCTAAGGACTGCACTATGCCTGCATAATTGTCTATGTTTTCAGTACTAGGAAAATCTTCTGTCTTGTTGAATAGTTATT
GAATTCAATTAGAGATCTGTTGATTACTGCCATGATATGTATGTCACTAATGCACAATTATGGTTATCATGCCATGCTGG
TCATTATTGTGATTCATAGGCATCATACCTGGGAAGGACTGTTGGTTACTTTTGTTCCTTGGAANCATGCNNANTGCCTT
TTGANACCATGAAAACNGNTCCTNAN
Sequence Type genomic DNA
Unitrap ID UNI26282

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 76896040..76896302 249
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046942 (2410003J06Rik) NP_082301 melanoma antigen family B, 16 Gene [Source:MGI Symbol;Acc:MGI:3644898]


Sequence tag IST14134H9HMF2
Sequence
CACTGTGCAGGATTANGCATTGTTTGTGTCTGTGCTCANTAAAGGCCGGTTGGGAACAATGACAAAACAGTTCGTCCTGT
TGATTCATGCGCTAAACGTATCANACAANTGAAAAAACCTGCCACCACTTGGTCTCACCAACAATTTCCCAGAANCNATT
TTGGATTANGGGTGGGGAGATGGGCAGCTCANTCCTGACAGCNNCTGCAACTGCCTTCATTTGGGCNGGGCGTGGAANAA
CCNCTCTTTANAATTTCATTCTATGGAGTGTACAGTGACTGGGCTTGGANTCTTGGAACACACTTGACTAGAGCCCTGAT
CATGACTGACTGCTTGGCTCACAGGGAATGGAGCNNNTGTGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000046942


For any suggestions or comments, please send an email to unitrap@crg.es