Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14466G3
Clone ID IST14466G3
Vector VICTR74
Project tigm

Sequence tag IST14466G3BBF1
Sequence
GTAACCACACAAGAATGTACTTATTGCCCCACATGCCAATACCAGTGACTTAGGCAGTCAGGTCTCACGTGGTAGGGCCA
GCTCGTCGCTTCCAGAAACGTCACATCCGTTGGGAACCTGACACAAGCCCGCCAGGGGCGAGTGCTTTTGTGAGAGGGCG
GAGTCCTAGCACGCGGATGGAACCTTGGTGGGGCGGAGCCTGTGGGGGCGGGACGAGGCCCGGGCAGGACGGGCCTCACT
TGCCGGCGTTTGCCGGCCCGGGCCACTACTTGTGANGAGCTCTGTGGCCNCGGAAGCAAGTGAGAGATTTCGACCANGTA
NGTGAGGATGGNAGGTNACNTGTGGCTCCNNCCNCN
Sequence Type genomic DNA
Unitrap ID UNI35131

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 71618498..71618846 335
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032806 (Slc10a3) NM_145406 solute carrier family 10 (sodium/bile acid cotransporter family), member 3 Gene [Source:MGI (curated);Acc:Slc10a3-002]


Sequence tag IST14466G3HMR1
Sequence
GTTACCTCCTCANATAAAAGTGGGTGATGGGAAGATGATGTCNGAGGACATTAAACTGATACTAAATTAAAGGTCATGTG
GTGATTGAAGTGATGGCTCANTGAGTGTTTACTACCTTTTCAGGACTCTGGTTCAACTTCACATTATCTACTTAGCAGCT
TGCANCCGCCTGTAACTACAGTTCAGGAGCTTTGATACCCTCTTCTTGCCTCTGCCCATACTGGATGCATATGGTGCACA
TACAAACATACNNNNNANCATANGCNTGTCATTTTTTAAAANGTGACTTGTATCCNGGTAGTTCTGTTATTGNNNNNNNN
NCNTCTCTCTCCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14466G3HMF1
Sequence
GTAACCACACAAGAATGTACTTATTGCCCCACATGCCAATACCAGTGACTTAGGCAGTCAGGTCTCACGTGGTAGGGCCA
GCTCGTCGCTTCCAGAAACGTCACATCCGTTGGGAACCTGACACAAGCCCGCCAGGGGCGAGTGCTTTTGTGAGAGGGCG
GAGTCCTAGCACGCGGATGGAACCTTGGTGGGGCGGAGCCTGTGGGGGCGGGACGAGGCCCGGGCAGGACGGGCCTCNCT
TGCCGGCGTTTGNCNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 71618595..71618846 250
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032806 (Slc10a3) NM_145406 solute carrier family 10 (sodium/bile acid cotransporter family), member 3 Gene [Source:MGI (curated);Acc:Slc10a3-002]

 
Come back to gene ENSMUSG00000032806


For any suggestions or comments, please send an email to unitrap@crg.es