Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14811G10
Clone ID IST14811G10
Vector VICTR76
Project tigm

Sequence tag IST14811G10HMF1
Sequence
CTAACAGGCAGCTGGAACTTGCTCTGCAGATCAGTAGTGTTTTTTCTGTAAGCTAAAACACCTCTTTCGCCTCTTGCAAC
TTGATCATACATGCCTCCTTACAGAAATCTGAGCCTTGCTGGANTGNTNTT
Sequence Type genomic DNA
Unitrap ID UNI30861

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 33023944..33024069 124
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040183 (Ankrd6) NM_001012450 ankyrin repeat domain 6 Gene [Source:MGI (curated);Acc:Ankrd6-002]


Sequence tag IST14811G10BBF1
Sequence
CTAACAGGCAGCTGGNACTTGCTCTGCAGATCAGTANTGTTTTTTCNGTNNGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000040183


For any suggestions or comments, please send an email to unitrap@crg.es