Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12991E5
Clone ID IST12991E5
Vector VICTR76
Project tigm

Sequence tag IST12991E5HMF1
Sequence
NCGCCTGTCTGTCATGGCCCTTCCTGTAATGTCCTATTCCAGGTACTGTACTCCTTACTGCTCGCCTGACCCCTCGGGCT
CAGGTTTCTGGTTCTTTCAGCGAGTGGAGTGGCTTGTTCTGGTTTGCATTTGCGGNNNTCCGGATCCNTTGACCCTCCCC
TATCTGGGAGCCCACCTTTTGTGCANATCCATGANAACCGTGGGTGTCTCATCTGTACNTCCNCTGGCCCCTTANCGGGG
TTTTGTCTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148120751..148121004 236
NO GENE  


Sequence tag IST12991E5BBF1
Sequence
NCGCCTGTCTGTCATGGCCCTTCCTGTAATGTCCTATTCCAGGTACTGTACTCCTTACTGCTCGCCTGACCCCTCGGGCT
CAGGTTTCTGGTTCTTTCAACGANTGNAGTGGCTTGTTCTGGTTTNCATTTNCNGCNCTCCNGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12991E5HMR1
Sequence
GGTCTAGCCTCAATTCCAGCTCAGTTAGTGTAGACATGGGGTCTAGCCTCAGTCCCAGCTCAGAAAGTTC
Sequence Type genomic DNA
Unitrap ID UNI33040

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 12937802..12937870 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031442 (Mcf2l) NM_178076 mcf.2 transforming sequence-like Gene [Source:MGI (curated);Acc:Mcf2l-009]

 
Come back to gene ENSMUSG00000031442


For any suggestions or comments, please send an email to unitrap@crg.es