Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10482C8
Clone ID IST10482C8
Vector VICTR76
Project tigm

Sequence tag IST10482C8HMF1
Sequence
GTGATGTCTTAGTATGTGTGCTGAAATTAGTANCATGGAGCCTCTGGTTTATAANCACACAAAGTGAGCTGAAAAGCAGT
TCAAAACACAGCAATGGGTAGTCTGTGTCATCAGGGCGTGATTGTATGGATTTTATTTTTCTTCCCCTATTTTNATGTGT
GTGANCTAAGTATGTACATGTACAGGTGAATGCCTGANGTTGCTGTTAGAATCACCCTTCATTGNTCTTCNNACTTCTTC
ATTGAGGCANGCTCTCTTCTNACNTGAAGTACCNATACGGCCAGNTTTTNNAGCTAGCTTTCTCTGGGCTTTGCTTGTCT
CTGNTTNCAAGGCTGCANNNNCTGGGTGANATCTGAACTGCAGTCCTCACGTTNGCGAGAGCTNTNANCCACTGACNCGT
CTTCCCANCCNATGCCTTGCCTTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10482C8BBF1
Sequence
GTGATGTCTTAGTATGTGTGCTGAAATTAGTAGCATGGAGCCTCTGGTTTATAAGCACACAAAGTGAGCTGAAAAGCAGT
TCAAAACACAGCAATGGGTAGTCTGTGTCATCAGGGCGTGATTGTATGGATTTTATTTTTCTTCCCCTATTTTCATGTGT
GTGAGCTAAGTATGTACATGTACAGGTGAATGCCTGAGGTTGCTGTTAGAATCACCCTTCATTGCTCTTCCAACTTCTTC
ATTGAGGCAGGCTCTCTTCTTACATGAAGTACCGATACGGCCAGCTTTTCGAGCTAGCTTTCTCTGGGCTTTGCTTGTCT
CTGCTTCCAAGGCTGCAGTTACTGGGTGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI16355

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 101951149..101951503 355
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048058 (Ldlrad3) NM_178886 low density lipoprotein receptor class A domain containing 3 Gene [Source:MGI (curated);Acc:Ldlrad3-001]

 
Come back to gene ENSMUSG00000048058


For any suggestions or comments, please send an email to unitrap@crg.es