Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15067B3
Clone ID IST15067B3
Vector VICTR80
Project tigm

Sequence tag IST15067B3HMF1
Sequence
GGGCAAATGGCTCTTTGATGCATCACAAAAGGTCCTTTGCGGGGAATTTGACTTGAGAGCCCCCAGGATTCCCTTCCCTG
AACAGCACTCCATAAAAGGAAGGATTCAGATTAGGGGGGGGGN
Sequence Type genomic DNA
Unitrap ID UNI2059

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 46083795..46083916 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037712 (Plekhc1) NM_146054 fermitin family homolog 2 (Drosophila) Gene [Source:MGI (curated);Acc:Plekhc1-001]


Sequence tag IST15067B3BBF1
Sequence
GGGCAAATGGCTCTTTGATGCATCACAAAAGGTCCTTTGCGGGGAATTTGACTTGAGAGCCCCCAGGATTCCCTTCCCTG
AACAGCACTCCATAAAAGGAAGGATTCAGATTAGGGGGGGGN
Sequence Type genomic DNA
Unitrap ID UNI2059

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 46083796..46083916 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037712 (Plekhc1) NM_146054 fermitin family homolog 2 (Drosophila) Gene [Source:MGI (curated);Acc:Plekhc1-001]

 
Come back to gene ENSMUSG00000037712


For any suggestions or comments, please send an email to unitrap@crg.es