Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11218H3
Clone ID IST11218H3
Vector VICTR76
Project tigm

Sequence tag IST11218H3BBF1
Sequence
GTCCGGCTGAAAGACTGGGAGGCCCANGTGTTTAAAATTCTGAAAGAGGGGTGAGGGGGTAGCCAGCCGCTGATAAAGAG
AGCCCTTGTCCTCACCTTCAACCTTGATTCCCACCCCCGCCCTCTTCATCGGAGGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI35136

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 144484191..144484330 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066026 (Dhrs3) NM_011303 dehydrogenase/reductase (SDR family) member 3 Gene [Source:MGI (curated);Acc:Dhrs3-002]


Sequence tag IST11218H3HMF1
Sequence
GTCCGGCTGAAAGACTGGGAGGCCCANGTGTTTAAAATTCTGAAAGAGGGGTGAGGGGGTAGCCAGCCGCTGATAAAGAG
AGCCCTTGTCCTCACCTTCNACCTTGATTCCCACCCCCGCCCTCTTCATCGGANGGGATCCTTCTNAGCTGGATTGGAAN
GTGGCACTGTGCCCCTCTGACCNCTGCCTCTTATTATGTGGGTGACACCNNCTCCCCATGCTCCAGGTTTTGGANACGTG
GTGTTGCANANTACTGGANGGAGAGCCNGCTGTCACCCANCTTGCNACTGCNNACCCGGCTGACTCACTNANTGGCAAGA
NCNNTGNAGAGGGATTTGAGGNCGGCAGGCCGGTCTGTCTCCANCCGGCCCGCGAANACNAANNNCAAACTNNNGAATNN
NNTTGAAATTTANNCTGNTGCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000066026


For any suggestions or comments, please send an email to unitrap@crg.es