Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10245D3
Clone ID IST10245D3
Vector VICTR76
Project tigm

Sequence tag IST10245D3BBF1
Sequence
TTACTCTGAGACAGACTCCTCCACTACCGCTGTTTATCTGGTAGCCAAGATAAGTAGCTTTCTACAAAGTTAGCTTTTCT
TTCTTCCTTTCTTTCTTTCTTTTTTAATTAGGTATTTTCTTCATTTACATTTCCAATGCTATCCCAAAAGTTCCCCCCAT
ACCCCCCCCCNNANNTNANCCTTTTTTTTTTTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI14352

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114423892..114424100 195
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031952 (Chst5) NM_019950 carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5 Gene [Source:MGI Symbol;Acc:MGI:1931825]


Sequence tag IST10245D3HMF1
Sequence
TTACTCTGAGACAGACTCCTCCACTACCGCTGTTTATCTGGTAGCCAAGATAAGTAGCTTTCTACAAAGTTAGCTTTTCT
TTCTTCCTTTCTTTCTTTCTTTTTTAATTAGGTATTTTCTTCATTTACATTTCCNATGCTATCCCAAAAGTTCCCCCCAT
ACCCCCCCCCNNAN
Sequence Type genomic DNA
Unitrap ID UNI14352

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114423931..114424100 168
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031952 (Chst5) NM_019950 carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5 Gene [Source:MGI Symbol;Acc:MGI:1931825]

 
Come back to gene ENSMUSG00000031952


For any suggestions or comments, please send an email to unitrap@crg.es