Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14330B3
Clone ID IST14330B3
Vector VICTR74
Project tigm

Sequence tag IST14330B3HMF2
Sequence
ACACAAATGGATTCAAGAGCATGGATTAACCCTGAAACAGTGCACTAAATGGAAGAAGTGGAATCCAGCCTGAACAGTAT
GGCTCCACTTGAATGAAATGTCCACTATAGGGATGCGTGCAGCCAGAAGAGACTGCTGAGGGAGAACTGACAAGAGTGGA
GGAGCAGAGCAGCAAATGCTAATCTATAACAGTGTCAGCTCTCTGAGGTGACAGGACTGTTTTAAAATTGACTATGACAA
TAGTTGCATGTATGAATAAACATACTAAAAGTCGCTGAGTCAGCAGTTCTCAACTTGTAGGTCACAAGCCCCTTGAAGGT
TC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108277906..108278226 321
 
EST/CDNA Est Name
  AW909198.1 - AW121874.1 - BE987480.1 - BE986396.1 - BE987278.1 - BF714023.1 - BE447306.1 - BF464895.1 - BG228559.1 - AW048537.1 - AW046259.1 - AI845193.1 - BE984435.1 - BE984980.1 - BF721825.1 - AI846809.1 - BE982131.1 - BE982104.1


Sequence tag IST14330B3HMR1
Sequence
GTGTTTNNTTCTTTTAATGGCTGTGAACTAATTTTCCNCATTTAACTTAATTAGGAATTGTTTGCCACTGACCTAAGAGC
TCTTATCCCCTTCTTTACTGAATATTTTAGCCTGTTTCAATAATTGGTCTTACTGAAAATAGAAATAATTACAACAGAAT
CTTGTTTTTTTAANAACTTCTTTTAATATACATAAAAGACAAGATTTGTGATTTCAAGAAAGCAGCTTACTTAAGCAAAA
GGCTTCTTGGCATTTTTNANCATAATAAAATATTTTANTGAGAGTGATGCAATCNTGTANTCC
Sequence Type genomic DNA
Unitrap ID UNI27871

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108277608..108277909 284
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000011831 (Evi5) NM_007964 ecotropic viral integration site 5 Gene [Source:MGI (curated);Acc:Evi5-001]


Sequence tag IST14330B3BBF1
Sequence
GGCCTATTTTTTGTGTATGAGTGTTTCCCTGCATGTATGCATATCCACATGTGTGTGTACTGCCCACAGAGGTCANAANA
AGTCATTGGATCT
Sequence Type genomic DNA
Unitrap ID UNI12836

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7587600..7587691 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031163 (Glod5) NM_027227 glyoxalase domain containing 5 Gene [Source:MGI (curated);Acc:Glod5-001]

 
Come back to gene ENSMUSG00000031163


For any suggestions or comments, please send an email to unitrap@crg.es