Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11217E7
Clone ID IST11217E7
Vector VICTR76
Project tigm

Sequence tag IST11217E7HMF2
Sequence
AAGTTCAAGTCCCAGCAACCACATGGTGGCTCACAACCATCTGTAACAAGATCTGACTCCCTCTTCTGGAGTGTCTGAAG
ACAA
Sequence Type genomic DNA
Unitrap ID UNI35140

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 65231537..65231619 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 80897965..80898047 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 60092079..60092161 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060703 (Cd302) NM_025422 CD302 antigen Gene [Source:MGI (curated);Acc:Cd302-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 36461165..36461247 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 98536236..98536318 83
NO GENE  


Sequence tag IST11217E7BBF1
Sequence
AAGTTCAAGTCCCAGCAACCACATGGTGGCTCACAACCATCTGTAACAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI35140

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 80897965..80898019 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 65231537..65231591 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 38635692..38635746 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 98536264..98536318 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 36461193..36461247 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 60092107..60092161 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060703 (Cd302) NM_025422 CD302 antigen Gene [Source:MGI (curated);Acc:Cd302-002]

 
Come back to gene ENSMUSG00000060703


For any suggestions or comments, please send an email to unitrap@crg.es