Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14637H7
Clone ID IST14637H7
Vector VICTR74
Project tigm

Sequence tag IST14637H7HMR1
Sequence
GGCTGCTCTTCCAGAGGTCCTGAGTTCAATTCCCAGCAACCACATGGTGGCTCATAACCATCTCTAATAGGATCTGATGC
CCTCTTCTGGTGTGTCTGAAGATGGCTACAGTGTACTCACATAAAATAAACAAATCTAAAAAAAAGAAAAAAAAAGAGCA
TTANCATCATATATACNGTTCTGTAACTTACGGCTCTTATTTAACNNTTGATGTTGTTC
Sequence Type genomic DNA
Unitrap ID UNI32608

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30737925..30738142 208
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059975 (Zfp74) NM_178384 zinc finger protein 72 Gene [Source:MGI (curated);Acc:Zfp74-003]


Sequence tag IST14637H7HMF2
Sequence
CAGCCGGTGCTCTTAACCNNTGAGCCNNTTCTCCAGCCCGTTACTGCTCTTTTAANAGGCCNNGCTCTTTATATGAGCAC
ATAAATGTACGCGTTCATGCTCACGAGTGTAAAGAAGTCAATTTGTCAGGAGCTGCATGACTGACTAGGAGAAATAAATA
ATTTTTAGTCTTTGGGCTTTTCTGTATCTTGCTATTTGGGAAATGGAGTTGGGCTGCAAGGCAAATGAATTTCGCCTGTC
ATGTACACAANACAGTTTGTCNATACAGGAAAATAGTCAAGTCCTGGAGATACTGATGCTTCATATAAAAATATTTTCAA
TTATTATAAACGGCTAAAGGTAGCACTCGTTCAAACGCGGTCTTCACACNTCTCCACANAATCCTACCCGCCTAAACTTC
NACNNNCAGAGTTTNTNNNTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30738138..30738550 380
 
EST/CDNA Est Name
  BB621686.1 - BE534724.1 - BY165308.1 - BY159855.1 - BY308145.1 - BY170150.1 - BY163939.1


Sequence tag IST14637H7BBF1
Sequence
CAGCCGGTGCTCTTAACCNCTGAGCCATTTCTCCAGCCCGTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30738138..30738180 41
NO GENE  

 
Come back to gene BB621686.1 - BE534724.1 - BY165308.1 - BY159855.1 - BY308145.1 - BY170150.1 - BY163939.1


For any suggestions or comments, please send an email to unitrap@crg.es