Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST1588-1
Clone ID PST1588-1
Vector U3NeoSV1
Project escells

Sequence tag PST1588-1
Sequence
TGTATATCCTTGAAGTATAAGCTTTAGGTTATTGATCTGAGTGTTTTGTTATTGTTGGTTGGTTTCTTTTATTGTGCTTT
TGAATTTTGAAACAAGGTCTAGTCCAGATTGGTCTTAATCTTAATATTTAGGCAGAGCTTAGCCTTGAATCAGTAACCCC
CCCTGTCTCTATTTGTCCAGTACTGGGATTACAAATATGCACCTTCTACTCCACCACACCCACCTCTGAAGTATTTTTTA
AAATGTAGACTGACAACTAAATTTCCCTCTGATGATTGTCATAACAACAGCTTATAAACTTTAGTATATATGCTATATTT
ATTTCTGAGTAGTCTATAATTGCCTTTGGCTTTTNTTTTTCTCTAACCCATTTTTTTTTGTTTT
Sequence Type genomic DNA
Unitrap ID UNI10402

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 37302044..37302427 380
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035437 (Rabgap1) NM_001033960 RAB GTPase activating protein 1 Gene [Source:MGI (curated);Acc:Rabgap1-004]

 
Come back to gene ENSMUSG00000035437


For any suggestions or comments, please send an email to unitrap@crg.es