Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AK0501
Clone ID AK0501
Vector pGT0lxr
Project sanger

Sequence tag AK0501
Sequence
GTCCCGCCTGCTTTTTACCTGTCTCCATCCTCACCTCTAACCTTCACGATCTTACCCTAATATCTTTAGACGCTCCTCCA
TGGATTCTCTTATATCCGCTTTACACTTCGTATACTTTTTTTCCGCTATTGTCCTAGACCTCCTTTCTCTAACACCTGTG
CGACAACTGTGTCCGCGCGCACCAGCGCGTCCGCCTCACCAAGGACCATTACATCGAGCGCGGCCCTCCGGGGCCTGCGG
CCGCCTCCGCGGCACAGCAGCTGGGGCTCGGGCCGCCCTTCGCGGGCGCGCCCTTCTCCATTCTCTCGGTGTTCCCGGAG
CGCCTCGGCTTCTGCCAGCACCACGACGATGAG
Sequence Type mRNA
Unitrap ID UNI536

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 114471423..114471625 203
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079259 (Trim71) NM_001042503 tripartite motif-containing 71 Gene [Source:MGI Symbol;Acc:MGI:2685973]

 
Come back to gene ENSMUSG00000079259


For any suggestions or comments, please send an email to unitrap@crg.es