Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14634C2
Clone ID IST14634C2
Vector VICTR74
Project tigm

Sequence tag IST14634C2HMR1
Sequence
NNANGAANANANNANTNNNTNNNNCTTGTCCNNATGCTANCCCCATCCAAAAGGACCCNNNTCNCCTCCTTCTTCTCTTC
CTCTGTCCAACCCAGAAATCCCGCCTACTCGCCCAGTGATTGGCTCCTTTATTCATTAGGGGATTGGTTCACAANAACAG
CACCTGGCCCATCCCCGACACATACAAGCAATTACACAGAAACACATATGATCACACATTACACAGTTACACAAGGCANA
TGAAGAGCTCCCATCTCTAACTTTGGAGTAAGTGAGGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87970306..87970560 237
NO GENE  


Sequence tag IST14634C2BBF2
Sequence
CCGGGTTTCGATGGTGGATCTGGTTGGGGTGGAAGCAGGTCCAAGTTTGTGGTCAGGTGAGACACAGGAGGAACATAGCT
GAGCCCAGGAAGGAGCAGGTAGAGTCGATCCCTCACAGACTCCAGAGAAGAGATGGTGTCTCACGGGACCAGCAGCAGAG
CAGTGCTTTTGACACACACATTCAGCTAACCTGAAGAGTAGGGTTAGGGAGCTATCTGGGCCAGAGCCTTTGTTGAAGTC
CATGGGTGTGCCTGATACGTATAGATCAAGCAGGCATGAGCCCCCACGATGTCACCTTGTGATGAAAGGGTCATCATGAA
GGCCTATCTGCACAGTGCATGTAGCCTGTCTGTCTGACAGGGANATGTCCCTAAGAAGAAAACCNCCTGAATGGCCCACA
CTGANGCTTGGGAGGGGTACAGANCTGGANACCCTGNCNNNGGATCCC
Sequence Type genomic DNA
Unitrap ID UNI35144

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 85101809..85102253 415
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006369 (Fbln1) NM_010180 fibulin 1 Gene [Source:MGI Symbol;Acc:MGI:95487]

 
Come back to gene ENSMUSG00000006369


For any suggestions or comments, please send an email to unitrap@crg.es