Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11447G1
Clone ID IST11447G1
Vector VICTR76
Project tigm

Sequence tag IST11447G1HMF1
Sequence
AGCTGGGACAGAAAGCAGCCAACGTTAAATGTCAGGGTAGCTGGATTGTATGTCCCTGTTAGGGAACGATCCACAGATAA
TAAATAAAGGTAACTGTAGTTTGACAGTCACATAGCCTTAGTGGCCTTGAGAAGAAACAAGGAATTCTCAAATGAAGCTT
CTCAAAGATTCTATCCCAAAGCCTGGTTAGAAGTTTATTAAAACCCCAGGCCATGCATGGTGGTACTCATCTTCATCCCA
GCCCTCGGGAAGCAGAGGCAGCTGGATTTGAGCTCGAGGCCAGCCTGGTCTACACAGTGAGTTCCAGGACAGCCAGGGCT
ACATAGTGAGACCCTGTCTCAAAAACAAAGCAATAAGGAGGTTGTATTAGTAGTAGGTTTCTCTGGGTAGTCCTGGCTGT
CTTGGAAGTCACTAAACTCAGAGATTTACCTGCCTCTGCNNCCACGTGCTGGGGTTAAAGGCATGTGTGTCTAGCTTAAA
AANGCNNCTATTAAAATACCAGTTTGGGCTGNANGTGTAACTN
Sequence Type genomic DNA
Unitrap ID UNI6070

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29689959..29690480 508
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069020 (Urm1) NM_026615 ubiquitin related modifier 1 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Urm1-001]

 
Come back to gene ENSMUSG00000069020


For any suggestions or comments, please send an email to unitrap@crg.es