Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10456C9
Clone ID IST10456C9
Vector VICTR76
Project tigm

Sequence tag IST10456C9HMR1
Sequence
TGGATTGCTTGTGAACAGAAAGAGGGTGGAACAGAGTTGAGAGTTTGGACCTGGTTACTACACTGGCAGATGTGTGTTTG
ATAGCTGATAAAGCAAACCTGTGTGTTTTCCCCAAACTCTTAGCAAAAAATTGGGTTTTTTTGTGCCTTGGTTTATTTTA
ATCNTCTCTGGATTATCTATCCAAAAATTGTTACTGTGCTAACATTGGGGATATTTCTTGCTGGATTGCATGTTGCTGTC
CTGTTANTTTCTCCCTCCCACCCCCNAANCANGCNTGTCTTTTTTTTTTTTTTTAN
Sequence Type genomic DNA
Unitrap ID UNI5169

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 92509904..92510197 280
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029405 (G3bp2) NM_001080795 GTPase activating protein (SH3 domain) binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:2442040]


Sequence tag IST10456C9BBF1
Sequence
CCAACTTGTGCTTCAGTGTAAAACGTTCAAAGATGTCATTCATCATCCTCATGTCCACTCNACAGAAAAGCAGGACAAAT
TAAGGCAGTTTAGAAAATAACTTCTAATATTCATAATGTGTAATGACAATTCTGCAACAAAGGAAAAACTGCTGTCAAGA
ATCTAAGGGCACTCTATGAGTATCTGTAAATTTCCAGTAGCTGATACTGAAAATTTTGGTATTTTAATCTCTAATACAAG
CTAGAGCTGCCCACACTGCCCTGCTACAAACAATGCCAACAATTTCTTCAAAACCNGAACTCACCTACTAATCCGGCTAC
TCANGTCATTGANTTAACATTTAGTCTANNTAGTAAACTTGCCCTANGTTCACAGGCCNAGGCTGAACAAGAAACTGCCT
TCATCATCAGCTAATGGTGGTTGGGTCTGGGTACTANCAAGGCAAATTGGTGCCTTGAACATGTCATTCANACTCTTANC
NNAAGTTAATCTTCTAAATTATCGAATGAATTCTTTANCTACAGACAGCCNCCCACTCTGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 92510195..92510735 511
 
EST/CDNA Est Name
  DV054232.1 - CF742787.1 - BQ180574.1 - CA945526.1 - CN458741.1 - CK637033.1 - BI414436.1 - CF748702.1 - CF734402.1 - BI414021.1 - BG297799.1 - CB521152.1 - CF726695.1 - BI526861.1 - BI558062.1 - CB182254.1 - BQ769814.1 - CF735139.1 - DV653165.1 - CN460401

 
Come back to gene DV054232.1 - CF742787.1 - BQ180574.1 - CA945526.1 - CN458741.1 - CK637033.1 - BI414436.1 - CF748702.1 - CF734402.1 - BI414021.1 - BG297799.1 - CB521152.1 - CF726695.1 - BI526861.1 - BI558062.1 - CB182254.1 - BQ769814.1 - CF735139.1 - DV653165.1 - CN460401


For any suggestions or comments, please send an email to unitrap@crg.es