Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13377D2
Clone ID IST13377D2
Vector VICTR74
Project tigm

Sequence tag IST13377D2BBF1
Sequence
CAAGCAGAANACCAATATGTAAAAAATTGCTTAAGAAAAGCAATGAGAGACCAAAAAAAAANAN
Sequence Type genomic DNA
Unitrap ID UNI19786

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 100448730..100448790 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031325 (4930519F16Rik) RIKEN cDNA 4930519F16 gene Gene [Source:MGI Symbol;Acc:MGI:1922356]


Sequence tag IST13377D2HMF1
Sequence
CAAGCAGAAGACCAATATGTAAAAAATTGCTTAAGAAAAGCAATGAGAGACCAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI19786

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 100448730..100448790 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031325 (4930519F16Rik) RIKEN cDNA 4930519F16 gene Gene [Source:MGI Symbol;Acc:MGI:1922356]

 
Come back to gene ENSMUSG00000031325


For any suggestions or comments, please send an email to unitrap@crg.es