Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13339E10
Clone ID IST13339E10
Vector VICTR74
Project tigm

Sequence tag IST13339E10BBF1
Sequence
GTAAGTAATAATTCAGGAGCATGGGAAGGGAGAGTGTGCTAGCCATGTGAAGGTTTGGGAGTCTTCNTNCCNNNNNNNNN
N
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30727590..30727651 62
NO GENE  


Sequence tag IST13339E10HMF1
Sequence
GTAAGTAATAATTCAGGAGCATGGGAAGGGAGAGTGTGCTAGCCATGTGAAGGTTTGGGAGTGGCCCTGCCACTTANCTG
CTTAGGGCATATTAAATATAAGGCTGTGTGAGTGTATG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30727590..30727707 116
NO GENE  


Sequence tag IST13339E10HMR1
Sequence
TTACTAAAACCTACATTCCAGCCTGGCTGCCCCAGCCTGCACCCTCCTGGACCATGATCCCCGACTCTTACACGTTGGCT
GTCTCTCTGTCCTGCACTTCTAAGGCCTAATCCTTCTACTTCCCTGGCATGGCATGCAGGTCTCCTACTTCCCTGGTCCC
TTGTCTGCACATCCTGAAGTCCCACCTCTGTCTCCTTGCCCACCCATT
Sequence Type genomic DNA
Unitrap ID UNI13145

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30727386..30727593 208
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059975 (Zfp74) NM_178384 zinc finger protein 72 Gene [Source:MGI (curated);Acc:Zfp74-003]

 
Come back to gene ENSMUSG00000059975


For any suggestions or comments, please send an email to unitrap@crg.es