Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14588F5
Clone ID IST14588F5
Vector VICTR74
Project tigm

Sequence tag IST14588F5HMR1
Sequence
TCACGGGAAAAGCANACNGGCTTTCACCTCTGGGATATGACNGGACTGTTCGGTGACTTACAACCTCTTTGATCCACATT
TGTGCATCTGATAGCAGCGATTACTACATTCTTTTTATTATTTTTTGTTTTTGTTTTTTCTCGAGACAGGATTTCTCTGT
ATTGCCCTGGCTGTCCTANAACTCACTTTGTAGACCAGGCTGGCCTCNAACTCANAAATCCGCCTGCCTCCGGAGTACTG
GGATTAAAGACGTGCGCCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 71115040..71115297 244
NO GENE  


Sequence tag IST14588F5HMF1
Sequence
AGACAATGGAAACAACTCTGTTTCCTTGATGATTCCTTCAGGTGGACGATGCCGAANAGCCGGAGAAAATGGCAGAGAGT
AAGACGTCCAATAAGTTCCAGTCCGTGGGAGTGCAAGTAGAAGAAGAGAAGTGGTAAGTCCCGAGGTGGAGGCTGGAGGC
GGCAGCACTTCCTGTCTGGGCGGTAGGAGGGTGGCACAGTATCTTCCCGTGTAAATACTTCCCGTGTAAATACAGCGTGG
CGGCTGCACTCATCTGTGGCTCTGCTCCCGTCTGANTGGCGAAGGGCCGCACAGTATTCATCCCGTGACAAGCCTGCAAG
CTCACTGGCCTTGCCACCTATGCTTGGGAGTGTTTAN
Sequence Type genomic DNA
Unitrap ID UNI22725

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 71115297..71115652 352
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003279 (Dlgap1) NM_177639 discs, large (Drosophila) homolog-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1346065]

 
Come back to gene ENSMUSG00000003279


For any suggestions or comments, please send an email to unitrap@crg.es