Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10257B12
Clone ID IST10257B12
Vector VICTR76
Project tigm

Sequence tag IST10257B12BBF1
Sequence
ATTTTATTTTGGTTTTTCGAGACAGGGTTTCTCTGTATACCCCTGGCTGTCCTGGAACTCAG
Sequence Type genomic DNA
Unitrap ID UNI33298

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 115998111..115998171 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 70721918..70721978 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033510 (Otud7a) NM_130880 OTU domain containing 7A Gene [Source:MGI (curated);Acc:Otud7a-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 108807513..108807573 59
NO GENE  


Sequence tag IST10257B12HMF2
Sequence
ATTTTATTTTGGTTTTTCGAGACAGGGTTTCTCTGTAT
Sequence Type genomic DNA
Unitrap ID UNI9955 UNI33298

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 115998111..115998148 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 57791802..57791839 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59661023..59661060 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035168 (Tanc1) NM_198294 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 Gene [Source:MGI (curated);Acc:Tanc1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 44248353..44248390 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 70721918..70721955 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033510 (Otud7a) NM_130880 OTU domain containing 7A Gene [Source:MGI (curated);Acc:Otud7a-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 108807513..108807550 38
NO GENE  

 
Come back to gene ENSMUSG00000033510


For any suggestions or comments, please send an email to unitrap@crg.es