Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12742A5
Clone ID IST12742A5
Vector VICTR76
Project tigm

Sequence tag IST12742A5HMF1
Sequence
CTGAGTTCGAGGCCNGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCGA
Sequence Type genomic DNA
Unitrap ID UNI2049 UNI15160 UNI32256 UNI32422 UNI34326 UNI35032

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4804682..4804756 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025903 (Lypla1) NM_008866 lysophospholipase 1 Gene [Source:MGI (curated);Acc:Lypla1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 18507550..18507624 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3299266..3299340 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020451 (Limk2) NM_001034030 LIM motif-containing protein kinase 2 Gene [Source:MGI (curated);Acc:Limk2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3617956..3618030 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 13612572..13612646 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8605177..8605251 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058570 (AC129222.4-202) Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q3TZ95]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 7111167..7111241 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054263 (Lifr) NM_013584 leukemia inhibitory factor receptor Gene [Source:MGI Symbol;Acc:MGI:96788]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 3553351..3553425 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 4756149..4756223 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3404799..3404873 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3537300..3537374 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 6126107..6126181 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039063 (Echdc3) NM_024208 enoyl Coenzyme A hydratase domain containing 3 Gene [Source:MGI (curated);Acc:Echdc3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 9766643..9766717 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027508 (Pag1) NM_053182 phosphoprotein associated with glycosphingolipid microdomains 1 Gene [Source:MGI Symbol;Acc:MGI:2443160]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 8290537..8290611 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 5702412..5702486 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 4934606..4934680 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4742167..4742241 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3462280..3462354 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 13620720..13620794 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166434: 104175..104249 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 5031347..5031421 73
NO GENE  


Sequence tag IST12742A5BBF1
Sequence
CTGAGTTCGAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACNCAGAGAAACCCTGTCTCGAAAAAA
AAN
Sequence Type genomic DNA
Unitrap ID UNI2049 UNI31488 UNI33657 UNI35147 UNI35148

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3537300..3537381 80
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 6292515..6292596 80
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 21867216..21867297 80
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 32072782..32072863 80
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 100535467..100535548 80
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 42296164..42296245 80
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 17274971..17275052 80
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 5736983..5737064 80
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 13647887..13647968 80
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037808 (2810485I05Rik) NM_176836 RIKEN cDNA 2810485I05 gene Gene [Source:MGI Symbol;Acc:MGI:1920076]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 41582315..41582396 80
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038332 (Sesn1) NM_001013370 sestrin 1 Gene [Source:MGI (curated);Acc:Sesn1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 59924664..59924745 80
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 38004078..38004159 80
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038600 (Atp6v0a4) NM_080467 ATPase, H+ transporting, lysosomal V0 subunit A4 Gene [Source:MGI (curated);Acc:Atp6v0a4-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4742167..4742248 80
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 65468677..65468758 80
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 42073048..42073129 80
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 111432859..111432940 80
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 19978141..19978222 80
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060090 (Rp2h) NM_133669 retinitis pigmentosa 2 homolog (human) Gene [Source:MGI (curated);Acc:Rp2h-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165733610..165733691 80
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4804682..4804763 80
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025903 (Lypla1) NM_008866 lysophospholipase 1 Gene [Source:MGI (curated);Acc:Lypla1-001]

 
Come back to gene ENSMUSG00000025903


For any suggestions or comments, please send an email to unitrap@crg.es